Top » Catalog » SNPs » A21221

$18.00

A21221
[A21221]

A21221
hg38 Position: ChrY:21042228..21042228
Ancestral: A
Derived: T
Reference: Alex Buchanan (2018)
ISOGG Haplogroup: R1b
Comments: Below DF13 > BY39001
Forward Primer: A21221_F AGGGGTTTTGAAGCTTGGAG
Reverse Primer: A21221_R CTAAAGCTCTAGCCCAAGGTTTTC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies