Top » Catalog » SNPs » A21222

$18.00

A21222
[A21222]

A21222
hg38 Position: ChrY:12843069..12843069
Ancestral: T
Derived: G
Reference: Zdenko Markovic (2018)
ISOGG Haplogroup: I2
Comments: Below Y4882
Forward Primer: A21222_F GCCGAGCTCTTCATTCTCTC
Reverse Primer: A21222_R TCACTTGATTAAAATGTGCTTCC
Reviews

Customers who bought this product also purchased
Y141127
Y141127
Y100616
Y100616
Y32084
Y32084
A22782
A22782
BY183912
BY183912
FGC7126
FGC7126
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies