Top » Catalog » SNPs » A21222

$18.00

A21222
[A21222]

A21222
hg38 Position: ChrY:12843069..12843069
Ancestral: T
Derived: G
Reference: Zdenko Markovic (2018)
ISOGG Haplogroup: I2
Comments: Below Y4882
Forward Primer: A21222_F GCCGAGCTCTTCATTCTCTC
Reverse Primer: A21222_R TCACTTGATTAAAATGTGCTTCC
Reviews

Customers who bought this product also purchased
M9
M9
Y4882
Y4882
M438
M438
A7358
A7358
L596
L596
M168
M168
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies