Top » Catalog » SNPs » A21222

$18.00

A21222
[A21222]

A21222
hg38 Position: ChrY:12843069..12843069
Ancestral: T
Derived: G
Reference: Zdenko Markovic (2018)
ISOGG Haplogroup: I2
Comments: Below Y4882
Forward Primer: A21222_F GCCGAGCTCTTCATTCTCTC
Reverse Primer: A21222_R TCACTTGATTAAAATGTGCTTCC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies