Top » Catalog » SNPs » Y70430

$15.00

Y70430
[Y70430]

Y70430
hg38 Position: ChrY:14641169..14641169
Ancestral: C
Derived: A
Reference: YFull (2016)
ISOGG Haplogroup: I2
Comments: .
Forward Primer: Y70430_F GGATAAGGCCCAGGAATCTG
Reverse Primer: Y70430_R TGCTTCATGCTTCATGCTTC
Reviews

Customers who bought this product also purchased
SK1241
SK1241
B57
B57
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies