Top » Catalog » SNPs » A21278

$18.00

A21278
[A21278]

A21278
hg38 Position: ChrY:12792998..12792998
Ancestral: T
Derived: A
Reference: Zdenko Markovic (2018)
ISOGG Haplogroup: I2
Comments: Below A5874
Forward Primer: A21278_F GCTTCTTAAATCCCCCTTGG
Reverse Primer: A21278_R TTCTGCTTGGAACGGTAAGG
Reviews

Customers who bought this product also purchased
A5877
A5877
CTS10228
CTS10228
Y43331
Y43331
A14798
A14798
L161.1
L161.1
Y4882
Y4882
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies