Top » Catalog » SNPs » A21278

$18.00

A21278
[A21278]

A21278
hg38 Position: ChrY:12792998..12792998
Ancestral: T
Derived: A
Reference: Zdenko Markovic (2018)
ISOGG Haplogroup: I2
Comments: Below A5874
Forward Primer: A21278_F GCTTCTTAAATCCCCCTTGG
Reverse Primer: A21278_R TTCTGCTTGGAACGGTAAGG
Reviews

Customers who bought this product also purchased
Y43331
Y43331
A14798
A14798
L161.1
L161.1
Y4882
Y4882
A5874
A5874
I2a-M423 Panel
I2a-M423 Panel
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies