Top » Catalog » SNPs » FGC56440

$18.00

FGC56440
[FGC56440]

FGC56440
hg38 Position: ChrY:21198174..21198174
Ancestral: G
Derived: A
Reference: Full Genomes Corp. (2016)
ISOGG Haplogroup: R1a
Comments: .
Forward Primer: FGC56440_F TGTAATCCCCACTGTTGGAGTC
Reverse Primer: FGC56440_R GGAAGAGGGGAGGTTAGACTTG
Reviews

Customers who bought this product also purchased
Z2123
Z2123
S15948
S15948
F1345
F1345
YP1347
YP1347
Z2124
Z2124
S23201
S23201
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies