Top » Catalog » SNPs » ZP81

$18.00

ZP81
[ZP81]

ZP81
hg38 Position: ChrY:14343273..14343273
Ancestral: A
Derived: G
Reference: Peter Op den Velde Boots (R-Z18 Project) (2015)
ISOGG Haplogroup: R1b1a2a1a2c1a (not listed)
Comments: Downstream Z2980 > FGC931 > ZP44
Forward Primer: ZP81_F CTCATTCAGCCTGGTTCAGC
Reverse Primer: ZP81_R TTCTCCACAGGGGCCAAC
Reviews

Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies