Top » Catalog » SNPs » A972

$19.00

A972
[A972]

A972
hg38 Position: ChrY:19844532..19844532
Ancestral: T
Derived: C
Reference: A. P. (2014)
ISOGG Haplogroup: R1b1a2a1a2c1j (not listed)
Comments: Downstream of A228
Forward Primer: A972_F TCCTGGTGCTGATACAAGACAG
Reverse Primer: A972_R TGTGCTTGCTTAGAGACATGC
Reviews
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
Currencies