Top » Catalog » SNPs » FGC59869

$18.00

FGC59869
[FGC59869]

FGC59869
hg38 Position: ChrY:8526066..8526066
Ancestral: C
Derived: G
Reference: Full Genomes Corp (2017)
ISOGG Haplogroup: R1b
Comments: Below DF13 > S16264
Forward Primer: FGC59869_F AAGGTGCTTCCAACTGCATC
Reverse Primer: FGC59869_R AGGTGTCAAGAAGCCCAGTC
Reviews

Customers who bought this product also purchased
A7313
A7313
FGC59880
FGC59880
R1b-S16264 Turner Panel
R1b-S16264 Turner Panel
FGC59873
FGC59873
A16005
A16005
A16004
A16004
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies