Top » Catalog » SNPs » FGC59880

$18.00

FGC59880
[FGC59880]

FGC59880
hg38 Position: ChrY:18967205..18967205
Ancestral: G
Derived: T
Reference: Full Genomes Corp (2017)
ISOGG Haplogroup: R1b
Comments: Below DF13 > S16264
Forward Primer: FGC59880_F TTCCAAGCAACTGGGACTTC
Reverse Primer: FGC59880_R AGGTTTCACATGTCCCATCC
Reviews

Customers who bought this product also purchased
FGC59869
FGC59869
A16005
A16005
A16004
A16004
A7314
A7314
A7313
A7313
FGC59873
FGC59873
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies