Top » Catalog » SNPs » FGC59880

$18.00

FGC59880
[FGC59880]

FGC59880
hg38 Position: ChrY:18967205..18967205
Ancestral: G
Derived: T
Reference: Full Genomes Corp (2017)
ISOGG Haplogroup: R1b
Comments: Below DF13 > S16264
Forward Primer: FGC59880_F TTCCAAGCAACTGGGACTTC
Reverse Primer: FGC59880_R AGGTTTCACATGTCCCATCC
Reviews

Customers who bought this product also purchased
A7314
A7314
A7313
A7313
FGC59873
FGC59873
R1b-S16264 Turner Panel
R1b-S16264 Turner Panel
FGC59869
FGC59869
A16005
A16005
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies