Top » Catalog » SNPs » A975

$18.00

A975
[A975]

A975
hg38 Position: ChrY:8740044..8740044
Ancestral: G
Derived: T
Reference: A. P. (2014)
ISOGG Haplogroup: R1b1a2a1a2c1j (not listed)
Comments: Downstream of A237
Forward Primer: A975_F GCAAGTCCAAATTGGAGAAGTAC
Reverse Primer: A975_R GCCAGGGATTTCCCAGAAG
Reviews

Customers who bought this product also purchased
Wish a SNP
Wish a SNP
A236
A236
FGC13914
FGC13914
A976
A976
A235
A235
FGC13899
FGC13899
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies