Top » Catalog » SNPs » BY25698

$18.00

BY25698
[BY25698]

BY25698
hg38 Position: ChrY:15859027..15859027
Ancestral: C
Derived: G
Reference: FTDNA (2018)
ISOGG Haplogroup: R1a
Comments: .
Forward Primer: BY25698_F CCAGGTGTTTATTATCTATCCATGTTG
Reverse Primer: BY25698_R GATGGGCATTAGGGTTGAAC
Reviews

Customers who bought this product also purchased
Y140329
Y140329
Y4135
Y4135
YP1337
YP1337
YP654
YP654
BY42327
BY42327
Y139304
Y139304
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies