Top » Catalog » SNPs » BY30715

$18.00

BY30715
[BY30715]

BY30715
hg38 Position: ChrY:19677296..19677296
Ancestral: C
Derived: T
Reference: FTDNA (2018)
ISOGG Haplogroup: R1a
Comments: L1029
Forward Primer: BY30715_F AAACTCTCAATCTTCCTAGGAACTACC
Reverse Primer: BY30715_R GGTCTCAAGGAAACTTTTGAATAAGTC
Reviews

Customers who bought this product also purchased
FGC66342
FGC66342
YP619
YP619
YP4648
YP4648
L1029
L1029
YP416
YP416
M458
M458
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies