Top » Catalog » SNPs » BY30715

$18.00

BY30715
[BY30715]

BY30715
hg38 Position: ChrY:19677296..19677296
Ancestral: C
Derived: T
Reference: FTDNA (2018)
ISOGG Haplogroup: R1a
Comments: L1029
Forward Primer: BY30715_F AAACTCTCAATCTTCCTAGGAACTACC
Reverse Primer: BY30715_R GGTCTCAAGGAAACTTTTGAATAAGTC
Reviews

Customers who bought this product also purchased
YSEQ-Alpha
YSEQ-Alpha
FGC64564
FGC64564
YP6046
YP6046
Y129780
Y129780
YP6048
YP6048
R1a-M458 Panel
R1a-M458 Panel
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies