Top » Catalog » SNPs » BY30715

$18.00

BY30715
[BY30715]

BY30715
hg38 Position: ChrY:19677296..19677296
Ancestral: C
Derived: T
Reference: FTDNA (2018)
ISOGG Haplogroup: R1a
Comments: L1029
Forward Primer: BY30715_F AAACTCTCAATCTTCCTAGGAACTACC
Reverse Primer: BY30715_R GGTCTCAAGGAAACTTTTGAATAAGTC
Reviews

Customers who bought this product also purchased
BY32105
BY32105
L260
L260
BY82357
BY82357
BY164730
BY164730
Y128623
Y128623
Y82336
Y82336
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies