Top » Catalog » SNPs » A976

$18.00

A976
[A976]

A976
hg38 Position: ChrY:12885446..12885446
Ancestral: G
Derived: A
Reference: A. P. (2014)
ISOGG Haplogroup: R1b1a2a1a2c1j (not listed)
Comments: Downstream of A237
Forward Primer: A976_F ATCCAATTTGTTGGCAAAGG
Reverse Primer: A976_R TGAGGCAGAAACAGAAAATTG
Reviews

Customers who bought this product also purchased
Wish a SNP
Wish a SNP
A977
A977
A236
A236
FGC13914
FGC13914
A975
A975
A235
A235
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies