Top » Catalog » SNPs » A977

$18.00

A977
[A977]

A977
hg38 Position: ChrY:16140029..16140029
Ancestral: C
Derived: A
Reference: A. P. (2014)
ISOGG Haplogroup: R1b1a2a1a2c1j (not listed)
Comments: Downstream of A237
Forward Primer: A977_F GTATGGGCCCTCTGTGACC
Reverse Primer: A977_R GTGCTTGGGTATCAAGCATGTAC
Reviews

Customers who bought this product also purchased
Wish a SNP
Wish a SNP
A240
A240
R1b-Z251 downstream 16
R1b-Z251 downstream 16
A979
A979
A237
A237
FGC13916
FGC13916
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies