Top » Catalog » SNPs » A979

$18.00

A979
[A979]

A979
hg38 Position: ChrY:19931828..19931828
Ancestral: C
Derived: T
Reference: A. P. (2014)
ISOGG Haplogroup: R1b1a2a1a2c1j (not listed)
Comments: Downstream of A237
Forward Primer: A979_F GAGATAAGGCTTTAAAGCAGTGATG
Reverse Primer: A979_R GGCTTTATGACTATTGGACAGGAC
Reviews

Customers who bought this product also purchased
Wish a SNP
Wish a SNP
A977
A977
A237
A237
FGC13916
FGC13916
A976
A976
A236
A236
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x DYS437
$9.95
Haplogroup Info
Other products
Currencies