Top » Catalog » SNPs » FGC20779

$18.00

FGC20779
[FGC20779]

FGC20779
hg38 Position: ChrY:7447714..7447714
Ancestral: T
Derived: G
Reference: Full Genomes Corp. (2014)
ISOGG Haplogroup: R1b
Comments: Below FGC20803
Forward Primer: FGC20779_F TCTTGAGGCTACCTCTGGGC
Reverse Primer: FGC20779_R GCAGACACAGTTCCCAGGC
Reviews

Customers who bought this product also purchased
FGC20791
FGC20791
R1b-Y14088 Soucek Panel
R1b-Y14088 Soucek Panel
FGC20798
FGC20798
FGC20782
FGC20782
FGC20805
FGC20805
FGC20790
FGC20790
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies