Top » Catalog » SNPs » FGC20779

$18.00

FGC20779
[FGC20779]

FGC20779
hg38 Position: ChrY:7447714..7447714
Ancestral: T
Derived: G
Reference: Full Genomes Corp. (2014)
ISOGG Haplogroup: R1b
Comments: Below FGC20803
Forward Primer: FGC20779_F TCTTGAGGCTACCTCTGGGC
Reverse Primer: FGC20779_R GCAGACACAGTTCCCAGGC
Reviews

Customers who bought this product also purchased
FGC20778
FGC20778
FGC20802
FGC20802
FGC20786
FGC20786
FGC20809
FGC20809
FGC20792
FGC20792
FGC20775
FGC20775
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies