Top » Catalog » SNPs » FGC20789

$18.00

FGC20789
[FGC20789]

FGC20789
hg38 Position: ChrY:13317453..13317453
Ancestral: G
Derived: A
Reference: Full Genomes Corp. (2014)
ISOGG Haplogroup: R1b
Comments: Below FGC20803
Forward Primer: FGC20789_F CCATGTTGGTCAGGTTGGTC
Reverse Primer: FGC20789_R AAGATTTCGCCTAATTGACACC
Reviews

Customers who bought this product also purchased
FGC20782
FGC20782
FGC20806
FGC20806
FGC20791
FGC20791
R1b-Y14088 Soucek Panel
R1b-Y14088 Soucek Panel
FGC20798
FGC20798
FGC20781
FGC20781
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies