Top » Catalog » SNPs » A980

$18.00

A980
[A980]

A980
hg38 Position: ChrY:22295356..22295356
Ancestral: C
Derived: A
Reference: A. P. (2014)
ISOGG Haplogroup: R1b1a2a1a2c1j (not listed)
Comments: Downstream of A237
Forward Primer: A980_F CTGCCTACTTGTGCTCTCAGC
Reverse Primer: A980_R GCTGAGACACCCCTGGAG
Reviews

Customers who bought this product also purchased
Wish a SNP
Wish a SNP
A236
A236
FGC13914
FGC13914
A975
A975
A235
A235
FGC13899
FGC13899
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies