Top » Catalog » SNPs » FGC20792

$18.00

FGC20792
[FGC20792]

FGC20792
hg38 Position: ChrY:15129116..15129116
Ancestral: T
Derived: C
Reference: Full Genomes Corp. (2014)
ISOGG Haplogroup: R1b
Comments: Below FGC20803
Forward Primer: FGC20792_F TTTGAATGGCAAAATGATCTG
Reverse Primer: FGC20792_R TGAGGACATGACTTGAAGTGTC
Reviews

Customers who bought this product also purchased
FGC20779
FGC20779
FGC20803
FGC20803
FGC20786
FGC20786
FGC20810
FGC20810
FGC20793
FGC20793
FGC20778
FGC20778
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies