Top » Catalog » SNPs » FGC20792

$18.00

FGC20792
[FGC20792]

FGC20792
hg38 Position: ChrY:15129116..15129116
Ancestral: T
Derived: C
Reference: Full Genomes Corp. (2014)
ISOGG Haplogroup: R1b
Comments: Below FGC20803
Forward Primer: FGC20792_F TTTGAATGGCAAAATGATCTG
Reverse Primer: FGC20792_R TGAGGACATGACTTGAAGTGTC
Reviews

Customers who bought this product also purchased
FGC20791
FGC20791
FGC20775
FGC20775
FGC20799
FGC20799
FGC20782
FGC20782
FGC20806
FGC20806
FGC20790
FGC20790
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
Haplogroup Info
Other products
Currencies