Top » Catalog » SNPs » FGC20802

$18.00

FGC20802
[FGC20802]

FGC20802
hg38 Position: ChrY:17355063..17355063
Ancestral: T
Derived: G
Reference: Full Genomes Corp. (2014)
ISOGG Haplogroup: R1b
Comments: Below FGC20803
Forward Primer: FGC20802_F TGTGCTTTCATTTGCATTTTG
Reverse Primer: FGC20802_R CCTTCTTCACAAGGGAGCAG
Reviews

Customers who bought this product also purchased
FGC20795
FGC20795
FGC20780
FGC20780
FGC20804
FGC20804
FGC20788
FGC20788
FGC20812
FGC20812
FGC20793
FGC20793
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies