Top » Catalog » SNPs » FGC20812

$18.00

FGC20812
[FGC20812]

FGC20812
hg38 Position: ChrY:6894832..6894835
Ancestral: ins
Derived: del
Reference: Full Genomes Corp. (2014)
ISOGG Haplogroup: R1b1a1a2a1a2b1c2
Comments: .
Forward Primer: FGC20812_F ACTCCCACTGAATTGCATCC
Reverse Primer: FGC20812_R AGGAGAAGGGGTCCAGCTAC
Reviews

Customers who bought this product also purchased
FGC20775
FGC20775
FGC20798
FGC20798
FGC20782
FGC20782
FGC20805
FGC20805
FGC20790
FGC20790
R1b-Y14088 Soucek Panel
R1b-Y14088 Soucek Panel
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies