Top » Catalog » SNPs » Y82249

$18.00

Y82249
[Y82249]

Y82249
hg38 Position: ChrY:6786494..6786494
Ancestral: G
Derived: T
Reference: YFull (2017)
ISOGG Haplogroup: E
Comments: .
Forward Primer: Y82249_F CTGTTCCTCTTCCTTATTTAAATGC
Reverse Primer: Y82249_R ACATGGAAGCAACTGCAGG
Reviews

Customers who bought this product also purchased
FGC86596
FGC86596
FGC86593
FGC86593
FGC86592
FGC86592
FGC63180
FGC63180
Y109284
Y109284
E1b David-2 Goodrich Panel
E1b David-2 Goodrich Panel
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies