Top » Catalog » SNPs » Y82249

$18.00

Y82249
[Y82249]

Y82249
hg38 Position: ChrY:6786494..6786494
Ancestral: G
Derived: T
Reference: YFull (2017)
ISOGG Haplogroup: E
Comments: .
Forward Primer: Y82249_F CTGTTCCTCTTCCTTATTTAAATGC
Reverse Primer: Y82249_R ACATGGAAGCAACTGCAGG
Reviews

Customers who bought this product also purchased
Y83795
Y83795
FGC86596
FGC86596
FGC86593
FGC86593
FGC86592
FGC86592
FGC63180
FGC63180
Y109284
Y109284
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies