Top » Catalog » SNPs » A21924

$18.00

A21924
[A21924]

A21924
hg38 Position: ChrY:16604049..16604049
Ancestral: T
Derived: C
Reference: Ed Aber Leek (2018)
ISOGG Haplogroup: R1b
Comments: Below Z3004 > FGC41930
Forward Primer: A21924_F CCTGTTGGTGGGTCCTCTAC
Reverse Primer: A21924_R CCCGAGATGCAGGATAACTG
Reviews

Customers who bought this product also purchased
Wish a SNP
Wish a SNP
A21926
A21926
A21925
A21925
A21923
A21923
A21922
A21922
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies