Top » Catalog » SNPs » A21933

$18.00

A21933
[A21933]

A21933
hg38 Position: ChrY:18984611..18984611
Ancestral: G
Derived: A
Reference: Zdenko Markovic (2018)
ISOGG Haplogroup: I2a
Comments: Below FGC56855
Forward Primer: A21933_F GTAGAGACGGGGTTTCACCG
Reverse Primer: A21933_R TGGCTCATTCCTGTAATCCTG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies