Top » Catalog » SNPs » A984

$18.00

A984
[A984]

A984
hg38 Position: ChrY:21466600..21466600
Ancestral: C
Derived: T
Reference: Iain Kennedy (2014)
ISOGG Haplogroup: R1b1a2a1a2c1a1a1 (not listed)
Comments: Below A223
Forward Primer: A984_F TGCTCAGGGCCTACACCG
Reverse Primer: A984_R GATCAGAGGCCAGCTTGCTA
Reviews

Customers who bought this product also purchased
A223
A223
A224
A224
R1b-DF49 (including M222) North West Irish Panel
R1b-DF49 (including M222) North West Irish Panel
A259
A259
A822
A822
S659
S659
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies