Top » Catalog » SNPs » A984

$18.00

A984
[A984]

A984
hg38 Position: ChrY:21466600..21466600
Ancestral: C
Derived: T
Reference: Iain Kennedy (2014)
ISOGG Haplogroup: R1b1a2a1a2c1a1a1 (not listed)
Comments: Below A223
Forward Primer: A984_F TGCTCAGGGCCTACACCG
Reverse Primer: A984_R GATCAGAGGCCAGCTTGCTA
Reviews

Customers who bought this product also purchased
A224
A224
R1b-DF49 (including M222) North West Irish Panel
R1b-DF49 (including M222) North West Irish Panel
A259
A259
A822
A822
S659
S659
A738
A738
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies