Top » Catalog » SNPs » A984

$18.00

A984
[A984]

A984
hg38 Position: ChrY:21466600..21466600
Ancestral: C
Derived: T
Reference: Iain Kennedy (2014)
ISOGG Haplogroup: R1b1a2a1a2c1a1a1 (not listed)
Comments: Below A223
Forward Primer: A984_F TGCTCAGGGCCTACACCG
Reverse Primer: A984_R GATCAGAGGCCAGCTTGCTA
Reviews

Customers who bought this product also purchased
BY18130
BY18130
S588
S588
A10528
A10528
A1775
A1775
DF85
DF85
ZS8379
ZS8379
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies