Top » Catalog » SNPs » Y134603

$18.00

Y134603
[Y134603]

Y134603
hg38 Position: ChrY:13739939..13739939
Ancestral: G
Derived: A
Reference: YFull (2018)
ISOGG Haplogroup: I2
Comments: .
Forward Primer: Y134603_F TTGTCACTGGGGCAAGTATTC
Reverse Primer: Y134603_R TGCCTGCTCTACACTTGTGC
Reviews

Customers who bought this product also purchased
Y5596
Y5596
Y97246
Y97246
A14973
A14973
A1221
A1221
Y14612
Y14612
Y126296
Y126296
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies