Top » Catalog » SNPs » Y134603

$18.00

Y134603
[Y134603]

Y134603
hg38 Position: ChrY:13739939..13739939
Ancestral: G
Derived: A
Reference: YFull (2018)
ISOGG Haplogroup: I2
Comments: .
Forward Primer: Y134603_F TTGTCACTGGGGCAAGTATTC
Reverse Primer: Y134603_R TGCCTGCTCTACACTTGTGC
Reviews

Customers who bought this product also purchased
I2-Y56203_DYS643=11 Panel
I2-Y56203_DYS643=11 Panel
BY8728
BY8728
Y21576
Y21576
Y134611
Y134611
Y134578
Y134578
Y134585
Y134585
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies