Top » Catalog » SNPs » A20657

$18.00

A20657
[A20657]

A20657
hg38 Position: ChrY:14492568..14492568
Ancestral: C
Derived: G
Reference: Kelly Wheaton (2018)
ISOGG Haplogroup: R1b (not listed)
Comments: Below U106 > Z156 > DF96 > S11515 > S15663 > FGC62079
Forward Primer: A20657_F TCAAAATTTCCGCCTCTGAC
Reverse Primer: A20657_R TTGGCTCATGCCTGTAAACC
Reviews

Customers who bought this product also purchased
mtUpgrade
mtUpgrade
DNA Sample Kit
DNA Sample Kit
FGC73745
FGC73745
FGC73735
FGC73735
Prepaid Return Envelope
Prepaid Return Envelope
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies