Top » Catalog » SNPs » FGC73735

$18.00

FGC73735
[FGC73735]

FGC73735
hg38 Position: ChrY:7494751..7494751
Ancestral: G
Derived: A
Reference: Full Genomes Corp. (2018)
ISOGG Haplogroup: R1b (not listed)
Comments: Below U106 > Z156 > DF96 > S11515 > S15663 > FGC62079
Forward Primer: FGC73735_F CACTCTAGTCCCTAAGAAACTTGGAAG
Reverse Primer: FGC73735_R AGAATTTGGAGAATGCCCAGAG
Reviews

Customers who bought this product also purchased
FGC73745
FGC73745
Prepaid Return Envelope
Prepaid Return Envelope
DNA Sample Kit
DNA Sample Kit
A20657
A20657
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x L829
$18.00
Haplogroup Info
Other products
Currencies