Top » Catalog » SNPs » A990

$18.00

A990
[A990]

A990
hg38 Position: ChrY:17109115..17109115
Ancestral: C
Derived: T
Reference: Paul Roche (2014)
ISOGG Haplogroup: R1b (not listed)
Comments: .
Forward Primer: A990_F CCTCCTTACACTTCTCTCTCCG
Reverse Primer: A990_R TGAGCTGATTACCCTCTCAAGG
Reviews

Customers who bought this product also purchased
A988
A988
A995
A995
A987
A987
A993
A993
A986
A986
A992
A992
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies