Top » Catalog » SNPs » ZS1313

$18.00

ZS1313
[ZS1313]

ZS1313
hg38 Position: ChrY:19327843..19327843
Ancestral: G
Derived: A
Reference: Victar Mas (2014)
ISOGG Haplogroup: J1 (not listed)
Comments: Found in Big Y sample 279797; approximate to L92.1
Forward Primer: ZS1313_F TGGGCACCTTATTGTTAGGG
Reverse Primer: ZS1313_R CTAAGCAGTTGGTGGCACAG
Reviews

Customers who bought this product also purchased
ZS8358
ZS8358
ZS1297
ZS1297
YSEQ-Alpha-Beta
YSEQ-Alpha-Beta
L93
L93
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
Haplogroup Info
Other products
Currencies