Top » Catalog » SNPs » BY4463

$18.00

BY4463
[BY4463]

BY4463
hg38 Position: ChrY:22237341..22237341
Ancestral: G
Derived: C
Reference: FTDNA (2016)
ISOGG Haplogroup: E
Comments: .
Forward Primer: BY4463_F TCACGAGGTCAGGAGATCAAG
Reverse Primer: BY4463_R CCAGATGCTCAGGAGGAATG
Reviews

Customers who bought this product also purchased
DYS481
DYS481
BY4455
BY4455
BY4464
BY4464
BY4462
BY4462
BY4456
BY4456
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies