Top » Catalog » SNPs » A18364

$18.00

A18364
[A18364]

A18364
hg38 Position: ChrY:7865482..7865482
Ancestral: C
Derived: G
Reference: YSEQ (2017)
ISOGG Haplogroup: R1b
Comments: R1b-L21 (x DF13 DF63 A5846 A7906 BY3031)
Forward Primer: A18364_F GCTTTACGTGATAACTGTCACACAG
Reverse Primer: A18364_R CAAGGGATGCTCAGCAGTC
Reviews

Customers who bought this product also purchased
A18370
A18370
A18374
A18374
A18373
A18373
A18372
A18372
DNA Sample Kit
DNA Sample Kit
Prepaid Return Envelope
Prepaid Return Envelope
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies