Top » Catalog » SNPs » A993

$18.00

A993
[A993]

A993
hg38 Position: ChrY:8141857..8141857
Ancestral: G
Derived: A
Reference: Paul Roche (2014)
ISOGG Haplogroup: R1b (not listed)
Comments: .
Forward Primer: A993v2_F AAAAGTAAATATTGGCCATCACTAGG
Reverse Primer: A993v2_R CGTTTTTAATTGTTAAAAACTAGTTGGC
Reviews

Customers who bought this product also purchased
DF98
DF98
BY128969
BY128969
Z301
Z301
L1
L1
Z381
Z381
FGC8410
FGC8410
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies