Top » Catalog » SNPs » A22121

$18.00

A22121
[A22121]

A22121
hg38 Position: ChrY:10009145..10009145
Ancestral: A
Derived: C
Reference: Michael Cooley (2018)
ISOGG Haplogroup: R1b
Comments: Below S6881
Forward Primer: A22121_F TTCTGCCGAAGTCTGGTTG
Reverse Primer: A22121_R GGATTTATGGGAAAGGTGGTG
Reviews

Customers who bought this product also purchased
A22244
A22244
A22245
A22245
A22242
A22242
A22243
A22243
A22119
A22119
S6881
S6881
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies