Top » Catalog » SNPs » A22126

$18.00

A22126
[A22126]

A22126
hg38 Position: ChrY:20611204..20611204
Ancestral: C
Derived: A
Reference: Brian Westrupp (2018)
ISOGG Haplogroup: R1b
Comments:
Forward Primer: A22126_F TCAGTCAGATCCAACCATGTG
Reverse Primer: A22126_R TCCAAAGTTTTGTTCCCTTATG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies