Top » Catalog » SNPs » A22127

$18.00

A22127
[A22127]

A22127
hg38 Position: ChrY:21004679..21004679
Ancestral: C
Derived: T
Reference: Brian Westrupp (2018)
ISOGG Haplogroup: R1b
Comments:
Forward Primer: A22127_F TATTTCAGACCCAGCCAAGG
Reverse Primer: A22127_R TGACACCTGAGCAATGTTCC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies