Top » Catalog » SNPs » A22129

$18.00

A22129
[A22129]

A22129
hg38 Position: ChrY:7549292..7549292
Ancestral: C
Derived: T
Reference: Brian Westrupp (2018)
ISOGG Haplogroup: R1b
Comments:
Forward Primer: A22129_F GACCAATCAAAAGTGGCCAG
Reverse Primer: A22129_R CCTACATTTAACACACAGAATACTGGATC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies