Top » Catalog » SNPs » A22130

$18.00

A22130
[A22130]

A22130
hg38 Position: ChrY:7463483..7463483
Ancestral: C
Derived: T
Reference: Brian Westrupp (2018)
ISOGG Haplogroup: R1b
Comments:
Forward Primer: A22130_F GCCCCATTCTGTCCTGG
Reverse Primer: A22130_R GTGCAGGTTTTTTTCATGATAGC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies