Top » Catalog » SNPs » BY45499

$18.00

BY45499
[BY45499]

BY45499
hg38 Position: ChrY:7377824..7377824
Ancestral: A
Derived: G
Reference: Linda Jonas (2018)
ISOGG Haplogroup: J2
Comments: Below Z631 > Y98609
Forward Primer: BY45499_F TTGGAGCTGTTTTTCCAAGC
Reverse Primer: BY45499_R GACCTCCTCAGGCTCAAGTG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies