Top » Catalog » SNPs » FGC8797

$18.00

FGC8797
[FGC8797]

FGC8797
hg38 Position: ChrY:7295421..7295421
Ancestral: C
Derived: T
Reference: Full Genomes (2014)
ISOGG Haplogroup: J1
Comments: Downstream FGC8810
Forward Primer: FGC8797_F GAGGTGGGTCAGTGTTATTCAGA
Reverse Primer: FGC8797_R ATCTCACTATTAAGCCTCATTCTAGAGGT
Reviews

Customers who bought this product also purchased
*TOP* - Top-Level Orientation Panel
*TOP* - Top-Level Orientation Panel
ZS8399
ZS8399
M96
M96
M267
M267
FGC1705
FGC1705
FT44186
FT44186
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies